Transcription And Translation Worksheet Pdf. Distinguish between the following. 2 a c t dna.
A nucleotide and nucleic acid b amino acid and protein c transcription and translation d template strand and non template strand. R tacgcgtataccgacattc st s caugcgcauauggcuguaag 3 aug cgc aua ugg cug uaa anticodons. What are the three major differences between dna rna.
Displaying top 8 worksheets found for dna transcription and translation.
T g t transcription mrna. Methionine arginine isoleucine tryptophan leucine using the example above transcribe the following dna strand into mrna and translate that. A codon chart can only be used for decoding a strand of mrna. T g t transcription mrna.
